JAMF Archive BioCompanion as published in 1995 THIS IS THE REFERENCE CODE AS PUBLISHED. Doelz, R. Optimal production of biological documentation: the JAM format. Comput. Applic. Biosci. 11, 224-226 (1995). The version you are currently viewing is the one printed and distributed via the Internet from the server of BioComputing Basel. Version 3.1 of the BioCompanion was published with version 2 of the JAMF software. The server that was indicated in the documentation has ceased to exist. Version 3.2 of the BioCompanion was not publicly available for free but was shareware that was distributed with GCG's software release 9. For the purpose of enhanced editing, JAMF was partially rewritten and the proprietary version 3.x of JAMF was used from 1996 onwards. The Biocompanion is available in a current version from the publisher . It has significantly changed both in software and content.
		JAMF source code	LATEX version source code
	location: Home > Archive > BioCompanion V2.x (1995)

Type in a Sequence

This section requires that the setup of the GCG software has been completed. The GCG software uses the program 'seqed' for this purpose, which will be explained below. If you have the sequence in electronic form already but did not use it in GCG before, refer to the previous chapters for details.

You might want to use a different program to type in sequences, such as text editors or PC-based software. The 'seqed' program runs on the central machine and, therefore, is only one of your options. If you choose a different environment, make sure that the sequences are either following GCG format conventions or may be reformatted to this format easily. PC users might also want to ensure that the infrastruucture to transfer data is well established.

Principle of the 'seqed' Program

The sequence editor seqed is a tool which allows to enter, manipulate, and edit biological sequences. It splits the screen in several areas as shown below. Use this graphic yourself and paint in how to "jump" in between different levels and areas after having read the documentation below .

NOTE: The session screen below uses only part of the available screen for didactic purposes. The 'seqed' program uses the full screen. Even if you use the graphical user interface WPI, 'seqed' will work as described below.

Screen dump:

 
  
                            :                                      :  
 heading area               :                                      :  
                            :                                      :  
                            :                                      :  
  
  
  
 sequence line              gcgctcgctcgctcgctcgctctggacagatagacagta  
 scale line                 :....|....:....|....:....|....:....|...  
 number line                    30         40        50        60  
  
 overview line              |~~~~^~~~~|~~~~~~~~~|~~~~~~~~~|~~~~   |   
                            0         100       200       300     400      
  
 command line               :  

 
 system prompt              $  
  

 
  
 ^ (caret)  displays the current position  
 ~ (tilde)  shows the length of the sequence symbolically.  
  

Online help: You might want to type "help" on the command line prompt.

Panic Recovery, "cannot delete...":

If you have problems to launch the sequence editor after a crash of the PC or other interruptions you might need to give the command

$ delete seqed.log;*

Alternatively, start 'seqed' without a sequence name to recover the previous session.

Panic Recovery, "illegal file name...":

If you have problems to launch the sequence editor and the program responds to your filename with the message illegal file name you might have no disk space available any longer. If disk quota are enabled on your system, refer to the corresponding section in the troubleshooting chapter .

Enter Your Sequence from Scratch

Start of the 'seqed' Program

$ seqed

You will then be prompted for the name of the sequence you want to edit. Do this by responding to the question

 
  
what file?  
  

If you have any additional, non-sequence information, such as reference or author information, type the text into the field you find the cursor (the top 4 lines of the screen). There, you should enter any annotation or reference needed to characterise the sequence. Then, exit this mode (which is called heading mode) with

<CTRL><Z>

Sequence Information and Exit

You are now on the sequence line, so enter the sequence. The sequence will appear character by character as you type it. This mode is the so-called screen mode. When completed, go to the command mode with the command

<CTRL><Z>

There, give the command 'exit' as follows:

<CTRL><Z>

: exit

================================= Begin Exercise 2

A small 'seqed' exercise: Type in a DNA sequence.

Use the sequence editor 'seqed' and type in the following sequence. Name it "my1.seq" - we will need this sequence in later exercises.

t g a t g g t c a a g t a a a c t a t g a a g a g t t t g t a c a a a t g a t g a c a g c a a a g t g c g a a g a c c t t g t a c a g a a t g t g t t a a a t t t c t t g t a c a a a a t t g t t t a t t n t g c c t t t t c t t t g t t t g t a a t t a t c t g t a a a a g n n n t c t c n n n n c c t a c t g t c a a g t c a t g t a t g a a a t c t a a c a a t g c g c t c a t c g t c a t c c t c g g

================================= End Exercise 2

Modification of an Existing File or Database Sequence

This section describes to use sequences which are already available in the GCG environment. WPI users might refer to the WPI chapter for details on how to use sequences in this envoronment. If you want to use sequences which are known in the sequence databases, you do not need to copy these data into your directory but rather use the name of the entry directly - use the local database section for reference.

Navigation

If you start the 'seqed' program on an existing file, you will end up directly on the command line. You may go to the command line with a special key combination as depicted below, and you may finally exit the program by typing exit.

The following Figure symbolises the screen of the sequence editing program on the left side, and the commands required to move from one level to the next are indicated with arrows.

 
  
   :                    :  
   :   (Heading area)   :           
   :                    :         ^                    |  
   :                    :         |                    |  
                                  | heading <RETURN>   |  <CTRL><D>  
                                  |                    v  
   AGCGCTGACAGCTGAGA              |         
   ....|....:....|....:..         | ^                  |  
   (sequence line)                | | <RETURN>         |  <CTRL><D>  
                                  | |                  v  
   :                             
   (command line)                 ^                    |  
                                  | seqed              |   exit  
                                  |                    v  
$ (system prompt)   
  

You then will be prompted for the name of the sequence you want to modify. Do this by responding to the question

 
  
what file?  
  

seqed screen mode commands are:

 
  
Symbol    meaning                       action   
------------------------------------------------------------------  
1         (number)                      jump to specified position   
-> <-     (arrows)                      move 1 left or right   
> <       (larger/smaller)              move 50 left or right  
10 ->     (number+cursor)               move number left or right  
/atg      (slash followed by pattern)   jump to pattern  
  

seqed command line mode commands are:

 
  
command (example)      command (general)  action   
----------------------------------------------------------------------------  
help                   help               on-line help  
1,200 Write test.seq   n,m write <file>   write sequence (fragment) to file  
300 Include test.seq   n include <file>   include new sequence (at pos. 300)                  
exit                   exit               save work and exit   
quit                   quit               cancel work and exit   
  

Use the sequence editor 'seqed' and view the DNA sequence with the accession number M19311. (You need to give the name as GENEMBL:M19311.) You shall extract the reading frame of this sequence - the start and stop codon can be found in the annotation of this sequence - you will want to seek the CDS (coding sequence) features, to find the desired codons there.

Name the newly created sequence "my2.seq" - we will need this sequence in later exercises.

================================= End Exercise 3

Reformatting from RNA, DNA, MSF or other GCG Formats

Reformatting tools have been described earlier . Do not mix up 'reformatting' in the GCG sense with 'importing' - the functionality might seem similar but an 'import' process is much more dangerous in terms of potential data loss.

Conversion in between GCG formats

The GCG software can tell you all options available with the check option applied to the program 'reformat'. This includes RNA, DNA, MSF file, FOSN file format, and mixed-case or all-uppercase or all-lowercase sequence data.

$ reformat /check

Problems in reformatting

Upon closer inspection of the GCG format, you might notice that the sequence type is recorded as part of the sequence. If you encounter problems in sequence handling, and are suspiciously assuming that 'the computer is wrong', make sure that the type of sequence is recoreded properly. Nucleotide sequences are determined to be non-protein if the GATC-content is beyond a certain threshold. The following options apply to the reformat program:

 
/PROtein                  insists that the sequences are reformatted as  
                            protein sequences  
/NUCleotide               insists that the sequences are reformatted as  
                            nucleic acid sequences