Chapter 7: Type in a Sequence

This section requires that the setup of the GCG software has been completed. The GCG software uses the program 'seqed' for this purpose, which will be explained below. If you have the sequence in electronic form already but did not use it in GCG before, refer to the previous chapters for details.

You might want to use a different program to type in sequences, such as text editors or PC-based software. The 'seqed' program runs on the central machine and, therefore, is only one of your options. If you choose a different environment, make sure that the sequences are either following GCG format conventions or may be reformatted to this format easily. PC users might also want to ensure that the infrastructure to transfer data is well established.

Section 7.1: Principle of the 'seqed' Program

[ Previous chapter ][ This chapter ][ Next chapter ] The sequence editor seqed is a tool which allows to enter, manipulate, and edit biological sequences. It splits the screen in several areas as shown below. Use this graphic yourself and paint in how to "jump" in between different levels and areas after having read the documentation below .

NOTE: The session screen below uses only part of the available screen for didactic purposes. The 'seqed' program uses the full screen. Even if you use the graphical user interface WPI, 'seqed' will work as described below.

Screen dump:

 

  
                            :                                      :
  
 heading area               :                                      :
  
                            :                                      :
  
                            :                                      :
  

  

  

  
 sequence line              gcgctcgctcgctcgctcgctctggacagatagacagta
  
 scale line                 :....|....:....|....:....|....:....|...
  
 number line                    30         40        50        60
  

  
 overview line              |~~~~^~~~~|~~~~~~~~~|~~~~~~~~~|~~~~   | 
  
                            0         100       200       300     400    
  

  
 command line               :
  

 
 system prompt              %
  

  

 

  
 ^ (caret)  displays the current position
  
 ~ (tilde)  shows the length of the sequence symbolically.
  

  

Online help: You might want to type "help" on the command line prompt.

Panic Recovery, "cannot delete...":

If you have problems to launch the sequence editor after a crash of the PC or other interruptions you might need to give the command

% rm seqed.log

Alternatively, start 'seqed' without a sequence name to recover the previous session.

Panic Recovery, "illegal file name...":

If you have problems to launch the sequence editor and the program responds to your filename with the message illegal file name you might have no disk space available any longer. If disk quota are enabled on your system, refer to the corresponding section in the troubleshooting chapter .